View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20790_low_19 (Length: 203)
Name: NF20790_low_19
Description: NF20790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20790_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 22568103 - 22567917
Alignment:
| Q |
1 |
aatttatgtatctgtgtgcatcagtgttgtccaatgatgtgcctatccatgagcaaacttttctcc-ataccacttttggtgaaaacacatgagaatcca |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22568103 |
aatttatgtatctgtgtgcatca---ttgtccaatgatgtgcctatccatgagcaaacttttctcccataccacttttggtgaaaacacatgagaatcca |
22568007 |
T |
 |
| Q |
100 |
atgtgtgaaatagtttccaagtcttgaaagaaaaatgcacacactaaattatggtttccatgtaagatacctcttttgctgagttcatta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22568006 |
atgtgtgaaatagtttccaagtcttgaaagaaaaatgcacacactaaattatggtttccatgtaagatacctcttttgccgagttcatta |
22567917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University