View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20791_high_2 (Length: 537)
Name: NF20791_high_2
Description: NF20791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20791_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-138; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-138
Query Start/End: Original strand, 240 - 509
Target Start/End: Original strand, 2739638 - 2739907
Alignment:
| Q |
240 |
aatattcgtcacattctctacaacatgataatcactagcaaaccaagacaattgttttcacattaattggtcttcaatatttgtgcacgtgtatttcctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2739638 |
aatattcgtcacattctctacaacatgataatcactagcaaaccaagacaattgttttcacattaattggtcttcaatatttgtgcacgtgtatttcctt |
2739737 |
T |
|
| Q |
340 |
gttcctccacgaccatataaggcatgcaagagctagcccaaaaatcttttaaagtaacaccatgattgatccaagcatccatggtgtccttactgaaacc |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2739738 |
gttcctccacgaccatataaggcatgcaagagctagcccaaaaatcttttaaagtaacaccgtgattgatccaagcatccatggtgtccttactgaaacc |
2739837 |
T |
|
| Q |
440 |
attgagcaaagaattctctactagcactaagatgtgctatcttcaaccataaagccatatccttaagact |
509 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||| |||| |||||||||||||||||| |
|
|
| T |
2739838 |
attgagcaaagaattctctactagcactaagatgtactatgttcaatcatatagccatatccttaagact |
2739907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 95 - 180
Target Start/End: Original strand, 2739551 - 2739636
Alignment:
| Q |
95 |
caatcaccatctaatactctaacaagaccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatcct |
180 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2739551 |
caatcaccatctaatactcgaacaaggccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatcct |
2739636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University