View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20791_high_8 (Length: 343)
Name: NF20791_high_8
Description: NF20791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20791_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 125 - 314
Target Start/End: Complemental strand, 42292860 - 42292674
Alignment:
| Q |
125 |
ctcaagactataaaggagagacaattaattgatcaaagatctttttgtattattatgaacatatgagtgcaatatttctaaagagaaacatatataaaca |
224 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42292860 |
ctcaagactataaaggagacacaattaattgatcaaagatctttttgtattat---gaacatatgagtgcaatatttcaaaagagaaacatatataaaca |
42292764 |
T |
|
| Q |
225 |
agattaatgaattttattaaatatttacaaatcaagatctcccattatatttatgataatgtgttatcgtcaaaacaccattgaagtctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292763 |
agattaatgaattttattaaatatttacaaatcaagatctcccattatatttatgataatgtgttatcgtcaaaacaccattgaagtctc |
42292674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 42292979 - 42292907
Alignment:
| Q |
5 |
acacagccttactattcacaatcaaccgcaggagcgatctcctgttcatgatccatctaactttgactctatac |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
42292979 |
acacagccttactattcacaatcaaccgcaggag-gatctcctattcatgatccatctaactttgactatatac |
42292907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University