View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20792_low_8 (Length: 223)
Name: NF20792_low_8
Description: NF20792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20792_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 204
Target Start/End: Complemental strand, 24222281 - 24222089
Alignment:
| Q |
12 |
agattattctgaggttgtcaatggtctgcctgtaaagtttaccaggctagaagcaggccatgatataatctcaacaaacacagcacttgatatcgcattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24222281 |
agattattctgaggttgtcaatggtctgcctgtaaagtttaccaggctagaagcaggccatgatataatctcaacaaacacagcacttgatatcgcattt |
24222182 |
T |
 |
| Q |
112 |
acaacaaagcccgactgtgctgaatcctccaagtgggtgttggttgatgattttaacaaattaactggaccatgggttggtattggtggtact |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24222181 |
acaacaaagcccgactgtgctgaatcctccaagtgggtgttggttgatgattttaacaaattaactggaccatgggttggtattggtggtact |
24222089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University