View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20793_low_2 (Length: 289)
Name: NF20793_low_2
Description: NF20793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20793_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 44548248 - 44547984
Alignment:
| Q |
18 |
atagcaaaatataagtttataggttcccgtaaacttaactcaaaaaa-ctaagagaaatataaccaagtgaaatgataactaagattttgatgtctctgt |
116 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548248 |
atagcaaaagataagtttataggtttccgtaagcttaactcaaaaaatctcagagaaatataaccaagtgaaatgataactaagattttgatgtctctgt |
44548149 |
T |
|
| Q |
117 |
atatttaactataaacatataggtgcaaagatatggtaaaatatgcgttatgaagatattgaagttcgtgttgtatggggttggaccaaatgaattttca |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548148 |
gtatttaactataaacatataggtggaaagatatggtaaaatatgggttatgaagatattggagttcgtgttgtatggggttggaccaaatgaattttca |
44548049 |
T |
|
| Q |
217 |
gccatctgcaaaagatgagcgagg----aacaaggacaaaatattcaagttagtgaaatgatgatg |
278 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548048 |
gccatctgc-aaagatgagcgaggaacaaacaaggacaaaatattcaagttagtgaaatgatgatg |
44547984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University