View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20794_high_20 (Length: 245)
Name: NF20794_high_20
Description: NF20794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20794_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 48874603 - 48874375
Alignment:
| Q |
1 |
agagattgttggtatagaggagatactttaggtactcatcagtgctatttatgaagtgtgcccaatatgccaccaatatctttactgttgcatgcttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48874603 |
agagattgttggtatagaggagatactttaggtactcatcagtgctatttatgaagtgtgcccaatatgccaccaatatctttactgttgcatgcttgga |
48874504 |
T |
|
| Q |
101 |
aaacacaacctgtttgttccgttgaaacatcgtaagaaaatatca-cctagatagtataaattttttattttattcataatatacaatgtcagtgtgaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48874503 |
aaacacaacctgtttgttccgttgaaacatcgtaagaaaatatcaccctagatagtataaattttttattttattcataatatacgatgtcagtgtgaag |
48874404 |
T |
|
| Q |
200 |
gttttttatacagttaataagtcataatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48874403 |
gttttttatacagttaataagtcataatt |
48874375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University