View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20794_low_19 (Length: 245)
Name: NF20794_low_19
Description: NF20794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20794_low_19 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 7210589 - 7210833
Alignment:
| Q |
1 |
aatgtatatgatttagaaaatctgttagattgatgaccgatgttttaaaaatcgaactgaaccagtcagttcgctgactggtttaataattttttagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7210589 |
aatgtatatgatttagaaaatctgttagattgatgaccgatgttttaaaaatcgaattgaaccagtcagttcgctgactggtttaataattttttagtat |
7210688 |
T |
 |
| Q |
101 |
ttatctgtcatctggtttaaccatggtttaatcgattaaaccatgactcagaggtctctgcggtttgatctccggtcttgtttttaaaacattgttgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
7210689 |
ttatctgtcatctggtttaaccatggtttaattgattaaaccatgactcagaggtctctgcggttagatctccgttcttgtttttaaaacattgttgatg |
7210788 |
T |
 |
| Q |
201 |
gcattattattgttgnnnnnnnattaatgtggctgcatgaagttt |
245 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
7210789 |
gcattattattgttgtttttttattaatgtggctgtatgaagttt |
7210833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 7196846 - 7196899
Alignment:
| Q |
1 |
aatgtatatgatttagaaaatctgttagattgatgaccgatgttttaaaaatcg |
54 |
Q |
| |
|
||||||||||||||||| || |||||| || ||||||||||||||| |||||| |
|
|
| T |
7196846 |
aatgtatatgatttagacaaattgttagttttatgaccgatgttttataaatcg |
7196899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 189
Target Start/End: Original strand, 7196912 - 7196948
Alignment:
| Q |
153 |
ggtctctgcggtttgatctccggtcttgtttttaaaa |
189 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
7196912 |
ggtctcagcggtttgatctctggtcttgtttttaaaa |
7196948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University