View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20794_low_22 (Length: 239)
Name: NF20794_low_22
Description: NF20794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20794_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 19653290 - 19653073
Alignment:
| Q |
18 |
tacattccgttgcacaaatcactcatttaaccatttaatctcgatgtctttagttattttgactctagaattgctgcttgggtgtaatgtaattgaaccg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19653290 |
tacattccgttgcacaaatcactcatttaaccatttaatctcgatgtgtttagatatt--gactctagaattgctgcttgggtgtaatgtaattgaatcg |
19653193 |
T |
 |
| Q |
118 |
actttttatagtgtgcgcaaaattttctccatggcttctttttctgttatattatcactggtattctttaattcatcgaccaactta-cttctttgaaaa |
216 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| | |||| ||||| |
|
|
| T |
19653192 |
acttgttatagtgtgtgcaaaattttctccatggcttctttttctgttatattatcactggtattcttcaatttgtcgaccaacttatcatcttggaaaa |
19653093 |
T |
 |
| Q |
217 |
atttcacgaatattttcatg |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19653092 |
atttcacgaatattttcatg |
19653073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University