View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20794_low_22 (Length: 239)

Name: NF20794_low_22
Description: NF20794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20794_low_22
NF20794_low_22
[»] chr5 (1 HSPs)
chr5 (18-236)||(19653073-19653290)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 19653290 - 19653073
Alignment:
18 tacattccgttgcacaaatcactcatttaaccatttaatctcgatgtctttagttattttgactctagaattgctgcttgggtgtaatgtaattgaaccg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||  ||||||||||||||||||||||||||||||||||||| ||    
19653290 tacattccgttgcacaaatcactcatttaaccatttaatctcgatgtgtttagatatt--gactctagaattgctgcttgggtgtaatgtaattgaatcg 19653193  T
118 actttttatagtgtgcgcaaaattttctccatggcttctttttctgttatattatcactggtattctttaattcatcgaccaactta-cttctttgaaaa 216  Q
    |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||||||| | |||| |||||    
19653192 acttgttatagtgtgtgcaaaattttctccatggcttctttttctgttatattatcactggtattcttcaatttgtcgaccaacttatcatcttggaaaa 19653093  T
217 atttcacgaatattttcatg 236  Q
    ||||||||||||||||||||    
19653092 atttcacgaatattttcatg 19653073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University