View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20794_low_24 (Length: 228)
Name: NF20794_low_24
Description: NF20794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20794_low_24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 9613173 - 9612951
Alignment:
| Q |
7 |
ctattgggtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttatggtatttctttttggtcatccacctatatacg--gcactgttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
9613173 |
ctattgggtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttatggtgtttctttttggtcatccgcctatatacacagcgttgttgt |
9613074 |
T |
|
| Q |
105 |
tttgtattttatataactggtctttgtttgtcttaaacatggatcgagtttttaataaattttactgttnnnnnnnnnnttgttgttgaaggtattttgg |
204 |
Q |
| |
|
|||||||| ||| | ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
9613073 |
tttgtattatatgttactggtctttgttcgtcttaaacatggatcaagtttttaataaattttactgtt-aaaaaaaaattgtcgttgaagatattttgg |
9612975 |
T |
|
| Q |
205 |
ataattttaagtgtttgtgaacaa |
228 |
Q |
| |
|
||||||||| |||| ||||||||| |
|
|
| T |
9612974 |
ataattttaggtgtctgtgaacaa |
9612951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 9081260 - 9081208
Alignment:
| Q |
10 |
ttgggtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttat |
62 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||| |||||| |||||| |
|
|
| T |
9081260 |
ttgggtgttgaaggtagatcttgattaagtgatgggtgtattgtgtcttttat |
9081208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 1945909 - 1945849
Alignment:
| Q |
14 |
gtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttatggtatttctttt |
74 |
Q |
| |
|
|||||||| |||||| |||||||| |||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
1945909 |
gtgttgaaagtaggttttggttaggtgatggttgtattgtgtcttttatggtatttctttt |
1945849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 74
Target Start/End: Original strand, 1946094 - 1946158
Alignment:
| Q |
10 |
ttgggtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttatggtatttctttt |
74 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||| ||| |||||| ||||||| |||||||||| |
|
|
| T |
1946094 |
ttggatgttgaaggtaggttttggttaggtgatgattgtattgtgtcttttatgatatttctttt |
1946158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 36275892 - 36275851
Alignment:
| Q |
11 |
tgggtgttgaaggtaggtcttggttagttgatgggtgttttg |
52 |
Q |
| |
|
||||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
36275892 |
tgggtgttgaaggtaggtcttggttaggtggtgtgtgttttg |
36275851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 31424557 - 31424612
Alignment:
| Q |
10 |
ttgggtgttgaaggtaggtcttggttagttgatgggtgttttgtgtattttatggt |
65 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31424557 |
ttgggtgttgaaagtagatcttggttaggtgatgattgttttgtgtattttatggt |
31424612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University