View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20795_low_4 (Length: 349)
Name: NF20795_low_4
Description: NF20795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20795_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 42 - 329
Target Start/End: Complemental strand, 31384120 - 31383833
Alignment:
| Q |
42 |
tgaagcttccgggagtgggaagcgtttccgggaggatcttgttgatacaagacctaagaatgtaacttaacataaacttttcgtttatatttactttttt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31384120 |
tgaagcttccgggagtgggaagcgtttccgggaggatcttgttgatacaagacctaagaatgtaacttaacataaacttttcgtttatatttactttttt |
31384021 |
T |
|
| Q |
142 |
cttgctatcaacacaaaattacattagttatatattttattaaactaattttgtttaattttggtgggtaagatcatccgtttaagctaaattgaacttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31384020 |
cttgctatcaacacaaaattacattagttatatattttattaaactaattttgtttaattttggtgggtaagatcatctgtttaagctaaattgaacttg |
31383921 |
T |
|
| Q |
242 |
gttttggtgagaaacagtgaattgctatttatctgggttttaaatagcggttgccatcatggtccggtggtattggcttgggacctgg |
329 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31383920 |
gttttggtgagaaacagtgtattgctatttatctgggttttaaatagcggttgccatcatggtccggtggtattggcttgggacctgg |
31383833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 31384238 - 31384281
Alignment:
| Q |
2 |
tgcagcatcatcggagaagcgttggttccgtcggcggaggtgaa |
45 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31384238 |
tgcagcatcatcggagaagcgtcggttccgtcggcggaggtgaa |
31384281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 301 - 329
Target Start/End: Complemental strand, 31623054 - 31623026
Alignment:
| Q |
301 |
tggtccggtggtattggcttgggacctgg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31623054 |
tggtccggtggtattggcttgggacctgg |
31623026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University