View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20795_low_5 (Length: 337)
Name: NF20795_low_5
Description: NF20795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20795_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 170 - 318
Target Start/End: Complemental strand, 8881700 - 8881552
Alignment:
| Q |
170 |
actaggatgagaatgcatttttcagagattatgcaacatcacacaagaaactctctgaattaggcttcaatcccagttgcagttatcgttcccaattggc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8881700 |
actaggatgagaatgcatttttcagagattatgcaacatcacacaagaaactctctgaattaggcttcaatcccagttgcagttatcgttcccaattggc |
8881601 |
T |
 |
| Q |
270 |
taaggcagctttaggaatggttattgcctcaactgttgtggtgctgggt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8881600 |
taaggcagctttaggaatggttattgcctcaactgttgtggtgctgggt |
8881552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 8881858 - 8881797
Alignment:
| Q |
11 |
cacagacaaggctctagttgatgatcctgcgttccgcaaatatgttgaactctatgctaagg |
72 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8881858 |
cacagataaggctctagttgatgatcctgcgttccgcaaatatgttgaactctatgctaagg |
8881797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University