View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20795_low_7 (Length: 291)
Name: NF20795_low_7
Description: NF20795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20795_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 2 - 274
Target Start/End: Original strand, 30439756 - 30440029
Alignment:
| Q |
2 |
ttcaacactaattgccttcatc-ccatcaccgctctttcacatgcttgtaaataagtagtctttgctgctttccaaaccaactccttcaagttcatcata |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30439756 |
ttcaacactaattgccttcatctccatcaccgctctttcacatgcttgtaaataagtagtctttgctgctttccaaaccaactccttcaagttcatcata |
30439855 |
T |
 |
| Q |
101 |
gtcttcaaaatctatatccatcacactatcttctttataactttcgtcttcactatcttcatcactttcacctgcaacattgatagaagtatcaacatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30439856 |
gtcttcaaaatctatatccatcacactatcttctttataactttcgtcttcactatcttcatcactttcacctgcaacattgatagaagtatcaacatgc |
30439955 |
T |
 |
| Q |
201 |
acaacttgttcacctcccacaannnnnnnaccttcgggcaaaacttgtaaagattgtgacaatggatttagtat |
274 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30439956 |
acaacttgttcacctcccacaaattttttaccttcaggcaaaacttgtaaagattgtgacaatggatttagtat |
30440029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University