View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20797_high_9 (Length: 257)
Name: NF20797_high_9
Description: NF20797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20797_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 959881 - 959635
Alignment:
| Q |
11 |
catcatcatatacacatatttagtcacatttttcaattgttaaatcgtactactctagggttttgtcaacnnnnnnnttcgtactactctagtgtttgtt |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
959881 |
catcatcatatgcacatatttagtcacatttttcaattgttaaatcgtactactctagggttttgtcaacaaaaaaattcgtactactctagtgtttgtt |
959782 |
T |
 |
| Q |
111 |
tataattttcaattgatggtgccaagtgttattaagaaagcaagttttcaaatgtctatgcacttccctagaactttcatgccaccccccatatcatata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
959781 |
tataattttcaattgatggtgccaagtgttattaagaaagcaagttttcaaatgtctatgcacttccctagaactttcatgccaccccccatatcatata |
959682 |
T |
 |
| Q |
211 |
attaattaagttgatgtgtcttcttattctaaattgagatgaattct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
959681 |
attaattaagttgatgtgtcttcttattctaaattgagatgaattct |
959635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University