View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20797_low_11 (Length: 251)
Name: NF20797_low_11
Description: NF20797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20797_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 49655964 - 49655730
Alignment:
| Q |
1 |
acggttttaaatttgtaattgaaatagttaggagtattattat---gcaagtaaaagtaaagttgcacggggtactaaataccaaacttggtaactaaag |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49655964 |
acggttttaaatttgtaattgaaatagttaggagtattattattatgcaagtaaaagtaatgttgcacggggtactaaataccaaacttagtaactaaag |
49655865 |
T |
 |
| Q |
98 |
caactgaaaaagtaactgacacaaaccaaattacttaaaaagttataaactgatataaagaaatcacaaaggggaattaagagagacaaacctggatcac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49655864 |
caactgaaaaagtaactgacacaaaccaaattacttaaaaagttataaactgatataaagaaatcacaaaggggaattaagagagacaaacctgtatcac |
49655765 |
T |
 |
| Q |
198 |
attttgcagaatgaactctatcagtgcagtaacac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49655764 |
attttgcagaatgaactctatcagtgcagtaacac |
49655730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 49713307 - 49713248
Alignment:
| Q |
177 |
agagagacaaacctggatcacattttgcagaatgaactctatcagtgcagtaacacctga |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49713307 |
agagagacaaacctgtatcacattttgcagaatgaactctatcagtgcagtaacacctga |
49713248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University