View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2079_high_15 (Length: 253)
Name: NF2079_high_15
Description: NF2079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2079_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 16 - 181
Target Start/End: Complemental strand, 47334071 - 47333908
Alignment:
| Q |
16 |
atgaaaatagatactaaacctgtgacgaatgaaaaaattgatgtgatnnnnnnntgatgaaaagttggctgctttcactgcagaccaacctcttgtctgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47334071 |
atgaaaatagatactaaacctgtgacgaatgaaaaaattgatgtgataaaaaaatgatgaaaagttggctgctttcactgcagaccaacctcttgtctgg |
47333972 |
T |
|
| Q |
116 |
tgggacgtttcattttatttttgtcgcaattcttaacactattttataggaatcccttttaagaat |
181 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
47333971 |
tgggacgtttcattttatttttgtcacaattc-taacatta-tttataggaatcccttttaagaat |
47333908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 47333817 - 47333771
Alignment:
| Q |
207 |
ttctaatctcaattacagaagaatacaaatttgtgactaaattaact |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47333817 |
ttctaatctcaattacagaagaatacaaatttgtgactaaattaact |
47333771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University