View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2079_high_17 (Length: 204)
Name: NF2079_high_17
Description: NF2079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2079_high_17 |
 | |
|
| [»] scaffold0097 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0097 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 38309 - 38106
Alignment:
| Q |
1 |
ttttttgggtgaagttaactatggctctggcatcagctggagatggtgcagcaacattcatgtcagcattgggaagaaatggtaattcacatgcaagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38309 |
ttttttgggtgaagttaactatggctctggcatcagctggagatggtgcagcaacattcatgtcagcattgggaagaaatggtaattcacatgcaagatg |
38210 |
T |
|
| Q |
101 |
ggataagatttgtgacaaatttgaaagctattgcaacagaggtggtggtgcccttattgcttctttcattggcttcattcttctcttgattatcactgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38209 |
ggataagatttgtgacaaatttgaaagctattgcaacagaggtggtggtgcccttattgcttctttcattggcttcattcttctcttgattatcactgtc |
38110 |
T |
|
| Q |
201 |
atgt |
204 |
Q |
| |
|
|||| |
|
|
| T |
38109 |
atgt |
38106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 22 - 181
Target Start/End: Complemental strand, 37100275 - 37100116
Alignment:
| Q |
22 |
tggctctggcatcagctggagatggtgcagcaacattcatgtcagcattgggaagaaatggtaattcacatgcaagatgggataagatttgtgacaaatt |
121 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| ||||||| ||| ||||| ||||||||||||||||||| |||| |||| || ||||||||||| |
|
|
| T |
37100275 |
tggctctagcatcaagtggagatggtgcagcaacagctatgtcagaattaggaaggaatggtaattcacatgcaaaatggaataaaatatgtgacaaatt |
37100176 |
T |
|
| Q |
122 |
tgaaagctattgcaacagaggtggtggtgcccttattgcttctttcattggcttcattct |
181 |
Q |
| |
|
||| ||||||||| |||||||||||| || | || || ||||||||||| ||||||| |
|
|
| T |
37100175 |
tgagtcctattgcaatagaggtggtggttccttaatagcctctttcattgggctcattct |
37100116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University