View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2079_high_7 (Length: 370)
Name: NF2079_high_7
Description: NF2079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2079_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 15 - 118
Target Start/End: Complemental strand, 19507875 - 19507772
Alignment:
| Q |
15 |
aagaaggacctttttgacattttgttgaacttgattgaagctgatgatggtgctgaaagtaaactcactagacaaagtgctaaagcttttgctctggtat |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19507875 |
aagaaggatctttttgacattttgttgaacttgattgaagctgatgatggtgctgaaagtaaactcactagacaaagtgctaaagcttttgctctggtat |
19507776 |
T |
|
| Q |
115 |
gaac |
118 |
Q |
| |
|
|||| |
|
|
| T |
19507775 |
gaac |
19507772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 243 - 370
Target Start/End: Complemental strand, 19507681 - 19507550
Alignment:
| Q |
243 |
taggaaatgatatagttaatttattgaatatgt--ctttaattttatgatagcttaga--aggtagatctcaatataaatcttttgaaatatggggtagg |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||| |||||||| ||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19507681 |
taggaaatgatatagttaatttattgaatatatgcctttaattatatgataggttatacaaggtagatctcaatataaatcttttgaaatatggggtagg |
19507582 |
T |
|
| Q |
339 |
atggcctatatatttagtcacattgcatcaat |
370 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |
|
|
| T |
19507581 |
atggcctatataattagtcacataacatcaat |
19507550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University