View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20800_high_6 (Length: 266)
Name: NF20800_high_6
Description: NF20800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20800_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 52828854 - 52829111
Alignment:
| Q |
1 |
tctaatatatagggtaccaattaatcaaatggtcaaacagaatgatgtcctgctttgctagagacttttttgtcaattccagcgagacattatagtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52828854 |
tctaatatatagggtaccaattaatcaaatggtcaaacagaatgatgtcctgctttgctagagacttttttgtcaattccagcgagacattatagtttta |
52828953 |
T |
|
| Q |
101 |
tcattctattgaaaatagtcactacaaccactccatctggctgtaatttacacaaatatacttattgacaaatgagtttataagtacggctaatcaccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52828954 |
tcattctattgaaaatagtcactacaaccactccatctggctgtaatttacacaaatatacttattgacaaatgagtttataagtacggctaatcaccta |
52829053 |
T |
|
| Q |
201 |
ttaacctaaacagttcatattttccaggtttccatgtcagatccgcctctttcttctc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52829054 |
ttaacctaaacagttcatattttccaggtttccatgtcagatccgcctctttcttctc |
52829111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University