View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20800_high_7 (Length: 259)
Name: NF20800_high_7
Description: NF20800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20800_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 44069851 - 44070081
Alignment:
| Q |
13 |
aatatttgcgttggtgttaattgcaggttattcatatagatcccaacaacaaagaagagatggatttttgggaagtaaataacagcaatattgctttgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44069851 |
aatatttgcgttggtgttaattgcaggttattcatatagatcccaacaacaaagaagagatggatttttgggaagtaaataacagcaatattgctttgat |
44069950 |
T |
 |
| Q |
113 |
ggcgaagaataactattcgggcagcaaggttgtagctcttgtatgccaaaacttcacttgtagtgcccctgtcactgatcattcgtcacttgaagctttg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44069951 |
ggcgaagaataactattcaggcagcaaggttgtagctcttgtatgccaaaacttcacatgtagtgcccctgtcactgatcattcgtcacttgaagctttg |
44070050 |
T |
 |
| Q |
213 |
ctctcccaaaaaccctcctcatagttgaata |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44070051 |
ctctcccaaaaaccctcctcatagttgaata |
44070081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University