View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20800_high_8 (Length: 231)
Name: NF20800_high_8
Description: NF20800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20800_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 2942648 - 2942845
Alignment:
| Q |
12 |
aagaaaatatctgaaaatatcatggcataatgtttctgtaatgcagccagttttgatttttaatgacctaggattgacttctgattttatattatgtcca |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
2942648 |
aagaaaatatctgaaaatatcatggcaaaatgtttctgtaatgcagccagttttgatttttaatgacctaggattgacttttgat-----attatgtccg |
2942742 |
T |
 |
| Q |
112 |
ccagagttattgtctctatagaaagcttttgaatatgagtttgacaggtttccttttctctaggagcccgggaaagatcataagtgtaagtgtccctaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2942743 |
ccagagttattgtctctatagaaagcttttgaatattagtttgacaggtttccttttttctaggagcccgggaaagatcataagtgtaagtgtccctaca |
2942842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University