View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20800_low_10 (Length: 207)
Name: NF20800_low_10
Description: NF20800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20800_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 35161332 - 35161506
Alignment:
| Q |
15 |
aatatgcatatggccaaaaacagtgttgtgacttgtgatgagaaaaatataaactactacggtcccaattcaatgagcgtggtacacttggtccaacggg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161332 |
aatatgcatatggccaaaaacagtgttgtgacttgtgatgagaaaaatataaactactacggtcccaattcaatgagcgtggtacacttggtccaacggg |
35161431 |
T |
 |
| Q |
115 |
aaaaaagtattggccacccactattacaattatgacatctcaatcatagaaacaaaattcttagaattctactct |
189 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161432 |
aaaaaagtattggccacccacgattacaattatgacatctcaatcatagaaacaaaattcttagaattctactct |
35161506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University