View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20800_low_4 (Length: 328)

Name: NF20800_low_4
Description: NF20800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20800_low_4
NF20800_low_4
[»] chr1 (4 HSPs)
chr1 (19-277)||(16578598-16578856)
chr1 (42-277)||(32803062-32803297)
chr1 (192-235)||(35465529-35465572)
chr1 (223-272)||(32809703-32809752)
[»] chr8 (1 HSPs)
chr8 (210-258)||(13212844-13212892)
[»] chr5 (1 HSPs)
chr5 (210-258)||(3332386-3332434)


Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 16578856 - 16578598
Alignment:
19 ctacaacagctcctggtgctgctggttgtctaagggtaacatttgcaactgatccactaccgcttagaacacaaaccccgcgttgtcgccttcttgcaaa 118  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16578856 ctacaacagctcctggtgctgcaggttgtctaagggtaacatttgcaactgatccactaccgcttagaacacaaaccccgcgttgtcgccttcttgcaaa 16578757  T
119 ctgggctacactttcggctacatctgctccggaggatacttccatcacatggcttttcagtgaatttggactgtctcttgttacgaagattggtggtttt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16578756 ctgggctacactttcggctacatctgctccggaggatacttccatcacatggcttttcagtgaatttggactgtctcttgttacgaagattggtggtttt 16578657  T
219 ggtttgttttttgaaccgggtggtcttcctcttggtcttcggtttccaatttcaactgc 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16578656 ggtttgttttttgaaccgggtggtcttcctcttggtcttcggtttccaatttcaactgc 16578598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 42 - 277
Target Start/End: Original strand, 32803062 - 32803297
Alignment:
42 ggttgtctaagggtaacatttgcaactgatccactaccgcttagaacacaaaccccgcgttgtcgccttcttgcaaactgggctacactttcggctacat 141  Q
    ||||||||||| |||||||| || || || ||||| || || ||||||||||| |||||||| ||||| ||||| || || ||||||||||| |||| ||    
32803062 ggttgtctaagagtaacattagctacagagccacttccactgagaacacaaacaccgcgttgacgcctccttgcgaattgtgctacactttctgctatat 32803161  T
142 ctgctccggaggatacttccatcacatggcttttcagtgaatttggactgtctcttgttacgaagattggtggttttggtttgttttttgaaccgggtgg 241  Q
    | |||||   || ||| ||||| |||||||| ||||  | |||||| || ||||||||||| ||||| |||||||||||| ||||||| || || |||||    
32803162 cagctccaccggctacctccatgacatggctcttcaaagcatttgggctatctcttgttacaaagataggtggttttggtctgtttttggatccaggtgg 32803261  T
242 tcttcctcttggtcttcggtttccaatttcaactgc 277  Q
    ||||||||||||||||||||| |||| ||| |||||    
32803262 tcttcctcttggtcttcggttaccaacttcgactgc 32803297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 235
Target Start/End: Original strand, 35465529 - 35465572
Alignment:
192 tctcttgttacgaagattggtggttttggtttgttttttgaacc 235  Q
    |||||||||| ||| |||||||||||||||||||||||||||||    
35465529 tctcttgttatgaatattggtggttttggtttgttttttgaacc 35465572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 32809703 - 32809752
Alignment:
223 tgttttttgaaccgggtggtcttcctcttggtcttcggtttccaatttca 272  Q
    ||||||| || || |||||||||||||||||||||||||| |||||||||    
32809703 tgtttttggatccaggtggtcttcctcttggtcttcggttaccaatttca 32809752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 210 - 258
Target Start/End: Original strand, 13212844 - 13212892
Alignment:
210 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 258  Q
    |||||||||||||||||||| ||||| | ||||||||||||||||||||    
13212844 ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 13212892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 210 - 258
Target Start/End: Original strand, 3332386 - 3332434
Alignment:
210 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 258  Q
    |||||||||||||||||||| || || | ||||||||||||||||||||    
3332386 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 3332434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University