View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20801_low_2 (Length: 227)

Name: NF20801_low_2
Description: NF20801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20801_low_2
NF20801_low_2
[»] chr2 (2 HSPs)
chr2 (68-211)||(2223538-2223681)
chr2 (16-48)||(2223516-2223548)


Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 68 - 211
Target Start/End: Original strand, 2223538 - 2223681
Alignment:
68 aattgaaaatagttgattaccatggtccatagagtaaggagataaagagaattagaagtagaaacgtatagagaactgagaagcttaactatcataaaat 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2223538 aattgaaaatagttgattaccatggtccatagagtaaggagataaagagaattagaagtagaaacgtatagagaactgagaagcttaactatcattaaat 2223637  T
168 agaagcacataaagaactaaactttcttaactaacatatgatag 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
2223638 agaagcacataaagaactaaactttcttaactaacatatgatag 2223681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 2223516 - 2223548
Alignment:
16 catagggtggatgcataaagataattgaaaata 48  Q
    |||||||||||||||||||||||||||||||||    
2223516 catagggtggatgcataaagataattgaaaata 2223548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University