View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20802_low_2 (Length: 377)
Name: NF20802_low_2
Description: NF20802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20802_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 19 - 367
Target Start/End: Complemental strand, 37089836 - 37089487
Alignment:
| Q |
19 |
aaaccatgttttatgaatctgtgtttctagagtgttatttgtttactttgtttttaattgatcacacatcaaattttcagatcttatcaatgtt--gatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37089836 |
aaaccatgttttatgaatctgtgtttctagagtgttatttgtttactttgtttttaattgatcacacatcaaattttcagatcttatcaatgttttgatg |
37089737 |
T |
|
| Q |
117 |
gaattgaaaatttattgttactatcgtgcatattttattttgtcttttttcattcttgctcaagacactttgattgtgttttctcttggaagagctattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37089736 |
gaattgaaaatttattgttactatcgtgcatattttattttgtcttttttcattcttgcttaagacactttgattgtgttttctattggaagagctattg |
37089637 |
T |
|
| Q |
217 |
ttgagtgatgtgtcatatttttgggttagctattgtgctgaatttatgattttttgtaggcatataatggtttatattttttctttctttcttgaggttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
37089636 |
ttgagtgatgtgtcatatttttgggttagctattgtgctgaatttatgattttttgtaggcatataatggtttataatttttc-ttctttcttgaggttt |
37089538 |
T |
|
| Q |
317 |
gaaaagatctaaaatttctgacctaggtggtggtgattagtattgcctttg |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37089537 |
gaaaagatctaaaatttctgacctaggtggtggtgattagtattgcctttg |
37089487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University