View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20802_low_3 (Length: 326)
Name: NF20802_low_3
Description: NF20802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20802_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 22 - 310
Target Start/End: Complemental strand, 29333 - 29045
Alignment:
| Q |
22 |
agagagttggatacaaatcaaaatcaccaatgactcaaagtaaaatatgtacagattaggcaaacctctaaaatgcaaatgaataatcaaagttttgttt |
121 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29333 |
agagagttggatacaaatcgaaattaccaatgactcaaagtaaaatatgtacagattaggcaaacctctaaactgcaaatgaataatcaaagttttgttt |
29234 |
T |
|
| Q |
122 |
tgtattggcactcttggttgccaacggttttactggaagtattaaccgcaaaatcacaggatgcggaggaaatcacatgcactttgataaagcctaagat |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29233 |
tgtattggcactcttggttgccaacagttttgttggaagtattaaccgcaaaatcacaggatgcggaggaaatcacatgcactttgataaagcctaagat |
29134 |
T |
|
| Q |
222 |
attgactttgccaaaaatcgtcaagaaagtgtttaggggcaatgtaccagatgtgatatcagagaaaagctgggaattggatagcaaac |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29133 |
attgactttgccaaaaatcgtcaagaaagtgtttaggggcaatgtaccagatgtgatatcagagaaaagctgggaattggatagcaaac |
29045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University