View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20802_low_5 (Length: 250)
Name: NF20802_low_5
Description: NF20802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20802_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 9233045 - 9233290
Alignment:
| Q |
1 |
taaaatattgacgtagcatataagcatgttagggtttttggcaacattagctattattaaggtctatagcgttcaacttaagaatagtcttactcataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9233045 |
taaaatattgacgtagcatataagcatgttagggtttttggcaacattagctattattaaggtctatagctttcaacttaagaatagtcttactcataaa |
9233144 |
T |
 |
| Q |
101 |
-catcgattattaaggtcatgtcttgtgcagtggttaagcttt------ttaattacttatcctaatttttctaactatgatattttaacaccctaactt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9233145 |
gcatcgattattaaggtcatgtcttgtgcagtggctaagctttttataattaattacttatcctaatttttctaactatgatattttaacaccctaactt |
9233244 |
T |
 |
| Q |
194 |
tatatacactcattcaacacttcattttatcttcacatctcttctt |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9233245 |
tacatacactcattcaacacttcattttatcttcatctctcttctt |
9233290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University