View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_30 (Length: 349)
Name: NF20803_high_30
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 16 - 342
Target Start/End: Complemental strand, 10885663 - 10885337
Alignment:
| Q |
16 |
ctttggtctttaaagcttcaaccatgtccaaaaatctcaaaacctttcatttttgcactacttggacctgctttgtttcatactataggtcacatttcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10885663 |
ctttggtctttaaagcttcaaccatgtccaaaaatctcaaaacctttcatttttgcactacttggacctgctttgtttcatactataggtcacatttcag |
10885564 |
T |
 |
| Q |
116 |
cttgtgtttcattctctaaggttgctgtgtctttcacacatgttattaaatcagcagaacctgttttttctgtcatattttcttctgttcttggtgatag |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10885563 |
cttgtgtttcgttctctaaggttgctgtgtctttcacacatgttattaaatcagcagaacctgttttttctgtcatattttcttctgttcttggtgatag |
10885464 |
T |
 |
| Q |
216 |
gtatccaattcaggtttggctttcaattttaccaattgtgcttggttgttctttagctgctgttactgaggtatctttcaatgttggaggattgtggtgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10885463 |
gtatccaattcaggtttggctttcaattttaccaattgtgcttggttgttctttagctgctgttactgaggtatctttcaatgttggaggattgtggtgt |
10885364 |
T |
 |
| Q |
316 |
gctctgattagcaatgttggttctgtg |
342 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
10885363 |
gctctgattagcaatgttggttttgtg |
10885337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University