View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_33 (Length: 317)
Name: NF20803_high_33
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 155 - 309
Target Start/End: Complemental strand, 29594427 - 29594275
Alignment:
| Q |
155 |
aaaaaatttaacattgttgcatcttagagagannnnnnnatcatctcattcaaatgtcgtcgtgtttattggtttattaattgtgannnnnnnnnnnnnn |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29594427 |
aaaaaatttaacattgttgtatcttagagaaatttttttatcatctcattcaaatgtcgtcgtatttattggtttattaattgtgatttattttttttt- |
29594329 |
T |
 |
| Q |
255 |
nggataaataggaaataaaaacaaatagaaattgagagtgacactatttcttctc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29594328 |
-ggataaataggaaataaaaacaaatagaaattgagagtgacactatttcttctc |
29594275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 29594529 - 29594456
Alignment:
| Q |
19 |
gccacgacactaattttcattatttttataatnnnnnnnttatttcttttttatctatcttaactagcatcgtt |
92 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
29594529 |
gccacgacactaattttcatcatttttataatcaaaaaattatttctttgttatctatcttaactagcatcgtt |
29594456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University