View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_44 (Length: 289)
Name: NF20803_high_44
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 2 - 283
Target Start/End: Original strand, 26258249 - 26258530
Alignment:
| Q |
2 |
agagaccacaccggggcattccagctccaacatgttctttgctcgtgtgacgacatcaaaaccatctcctgagagggagaggttgatgtcggtatcacgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
26258249 |
agagaccacaccggggcattccagctccaacatgttctttgctcgtgtgacgacctcaaaaccgtctcctgagagggagaggttgatgtcggcatcacgt |
26258348 |
T |
 |
| Q |
102 |
tctgccttgttgaaagaattggaggatactaggacagatgcatcacaacctccaatcatgcaatcgctgaagaagaggcggagtgcagcgccagcggttg |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258349 |
tctgccttgttgaaggaattggaggatactaggacagatgcatcacaacctccaatcatgcaatcgctgaagaagaggcggagtgcagcgccagcggttg |
26258448 |
T |
 |
| Q |
202 |
aaggtgttgttttctgcttatcagttacggtttgcttgacgatgtcttcaaatttaggacatgatttttggtagtagtttgg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258449 |
aaggtgttgttttctgcttatcagttacggtttgcttgacgatgtcttcaaatttaggacatgatttttggtagtagtttgg |
26258530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University