View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_51 (Length: 262)
Name: NF20803_high_51
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 36007563 - 36007336
Alignment:
| Q |
13 |
ataagggaagggactttggtaatatgtattttag-gatagatcatcatattatagttgttaacatgttattattgcaaagaaattnnnnnnnnnttgtgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
36007563 |
ataagggaagggactttggtaatatgtattttagagatagatcatcatattatagttgtta--------ttattgcaaagaaattaaaaaaaaattgtgg |
36007472 |
T |
|
| Q |
112 |
tgtatgctatgaataaccttttaattatcaaacgcaattccaagaggaattgttctacataaaatacacccgtgctgaattccaatgacaatggtatttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36007471 |
tgtatgctatgaataaccttttaattatcaaacgcaattccaagagaaattgttctacataaaatacacccgtgctgaattccaatgacaatggtatttc |
36007372 |
T |
|
| Q |
212 |
ttttgaattttttatatttagagcaagagtagtagt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36007371 |
ttttgaattttttatatttagagcaagagtagtagt |
36007336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University