View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_53 (Length: 258)
Name: NF20803_high_53
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 25698156 - 25698335
Alignment:
| Q |
1 |
tatgtcagagaaaaccgtgtttttgcttatggatcgatttgtcccttggtgattttgtagctt------cttgtgnnnnnnngttacaagattaattaag |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| | || || |||||| | ||||||||||||||| |
|
|
| T |
25698156 |
tatgtcagagaaaactgtgtttttgcttatggatcgatttgtcccttggtgatgatatatattttgtagcttgtgttcttttctaacaagattaattaag |
25698255 |
T |
 |
| Q |
95 |
atgcatggtttgtattgcatatctactcgatcgatcaatgcattttaattttcatagtccgtgagacttaatatgcaaat |
174 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25698256 |
atgcatggtttttattgtatatatactcgatcgatctatgcattttaattttcatagtccgtgagacttaatatgcaaat |
25698335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 81 - 152
Target Start/End: Original strand, 25681666 - 25681737
Alignment:
| Q |
81 |
caagattaattaagatgcatggtttgtattgcatatctactcgatcgatcaatgcattttaattttcatagt |
152 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||| |||||||| ||| || ||| |||||||||| |
|
|
| T |
25681666 |
caagattaattgagatgcatggtttgtattgtatatatacttgatcgatctatgtatgttacttttcatagt |
25681737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 25681553 - 25681605
Alignment:
| Q |
1 |
tatgtcagagaaaaccgtgtttttgcttatggatcgatttgtcccttggtgat |
53 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
25681553 |
tatgtcagaggcaaccgtgtgtttgcttatggatcgatttgttccttggtgat |
25681605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University