View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_56 (Length: 252)
Name: NF20803_high_56
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 7378567 - 7378347
Alignment:
| Q |
17 |
gtttcaacttactggttcaattagtttcattgttcactaccctttgtacactggatttctaacaattcagttttaaacatgagaataattgatcctaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7378567 |
gtttcaacttactggttcaattagtttcattgttcactaccctt-gtaaactggatttctaacaattcagttttaaacatgagaataattgatcctaagt |
7378469 |
T |
|
| Q |
117 |
ttgcaattcagtttttgaccgtggagttccgatgaaatctagtgcattagttttgatgagactttga--nnnnnnnncaatatgaatcaaggaaatctct |
214 |
Q |
| |
|
| |||||||||||||||||| |||||||| |||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7378468 |
tagcaattcagtttttgaccatggagttctgatggaatttagtgcattagttttgatgagactttgattttttttttcaatatgaatcaaggaaatctct |
7378369 |
T |
|
| Q |
215 |
aaatcatatttcaattggttca |
236 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
7378368 |
aaattatatttcaattggttca |
7378347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University