View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_58 (Length: 246)
Name: NF20803_high_58
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 29394684 - 29394574
Alignment:
| Q |
126 |
atcatattattattctttagcaaagacataaacacagatctctacacatcttgtgatcataccttattcaatttggaaggtgtgtcttagttaatgattt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394684 |
atcatattattattctttagcaaagacataaacacagatctctacacatcttgtgatcataccttattcaatttggaaggtgtgtcttagttaatgattt |
29394585 |
T |
 |
| Q |
226 |
tgtaatttcat |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
29394584 |
tgtaatttcat |
29394574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University