View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_high_61 (Length: 238)
Name: NF20803_high_61
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 25698139 - 25697980
Alignment:
| Q |
1 |
tgtctctacgaggaacaccaacgttgtcattgttgttttgatctattgcttgtttggattttgagaacaaaggattgctg---ataggaagaactttttc |
97 |
Q |
| |
|
|||||||| | ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25698139 |
tgtctctaaggggaacaccaacgttgtccttgttgttttgatctattgcttgcttggattttgagaacaaaggattgctgctgataggaagaactttttc |
25698040 |
T |
 |
| Q |
98 |
tctgagctttgaaagtttaccaacccatacttctgcaattgcacccatttttcttagcac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
25698039 |
tctgagctttgaaagtttaccaacccatgcctctacaattgcacccatttttcttagcac |
25697980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 25681516 - 25681417
Alignment:
| Q |
12 |
ggaacaccaacgttgtcattgttgttttgatctattgcttgtttggattttgagaacaaaggattgct---gataggaagaactttttctctgagctttg |
108 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| | | ||||||| |||||| | |||||| ||||| | | ||||||||||||||||||||||||| |
|
|
| T |
25681516 |
ggaacaccaacgttcttcttgttgttttgatctgctccatgtttggcttttgaaagcaaaggcttgctcttgttgggaagaactttttctctgagctttg |
25681417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University