View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_15 (Length: 435)
Name: NF20803_low_15
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 3915483 - 3915721
Alignment:
| Q |
18 |
aatctgagcaagaacaatttaacaggacctattcccgcagagtttggtaatctcaaaagtatcatggaaatgtaagttatatatttttctaatgaaaatt |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915483 |
aatctgagcagaaacaatttaacaggacctattcccgcagagtttggtaatctcaaaagtatcatggaaatgtaagttatatatttttctaatgaaaatt |
3915582 |
T |
 |
| Q |
118 |
ttaagtattagtttatttgttttattcccttgattattctatttgcttctatgtggcagtgatctttcccataaccaactctctgagatgattcctgtag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915583 |
ttaagtattagtttatttgttttattcccttgattattctatttgcttctatgtggcagtgatctttcccataaccaactctctgagatgattcctgtag |
3915682 |
T |
 |
| Q |
218 |
aacttggtcagcttcagagcatagcatcattgtaagctg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915683 |
aacttggtcagcttcagagcatagcatcattgtaagctg |
3915721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 332 - 427
Target Start/End: Original strand, 3915797 - 3915892
Alignment:
| Q |
332 |
atttacttggtttgaaataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacatcgcttgtaaattgtcttagtctctctctgct |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3915797 |
atttacttggtttgaaataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacatcacttgtaaattgtcttagtctctctctgct |
3915892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 348 - 427
Target Start/End: Complemental strand, 34959488 - 34959409
Alignment:
| Q |
348 |
ataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacatcgcttgtaaattgtcttagtctctctctgct |
427 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||| |
|
|
| T |
34959488 |
ataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacgtcgcttgtaaactgtcgtagtctctctctgct |
34959409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University