View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_27 (Length: 355)
Name: NF20803_low_27
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 13 - 338
Target Start/End: Original strand, 952984 - 953310
Alignment:
| Q |
13 |
aatatatcaaaactgcatatctgccaaaaatgttggtaaaatcccaagttgaaacctttagaacctggacacttatctgctagcaaagagaacatttcct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952984 |
aatatatcaaaactgcatatctgccaaaaatgttggtaaaatcccaagttgaaacctttagaacctggacacttatctgctagcaaagagaacatttcct |
953083 |
T |
 |
| Q |
113 |
ctttaaattccacaacgcaaaaaggcacaacgagat-ggtattttcatcttctgagatcacctgatttgtggcgttaatcactgatgcacgcacactgtc |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
953084 |
ctttaaattcctcaacgcaaaaaggcacaacgagataggtattttcatcttctgagatcacctgatttgtggcgttaatcactgatgcacgcacactgtc |
953183 |
T |
 |
| Q |
212 |
agtaacctgaaacaaaccaggaaaatgaatctttggccacattggcgatatgtacttcatttgtgcccgcacttcatttgcatcttcaaaataggataat |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
953184 |
agtaacctgaaacaaaccagaaaaatgaatctttggccacattgacgatatgtacttcatttgtgcccgcacttcatttgcatcttcaaaataggataat |
953283 |
T |
 |
| Q |
312 |
attaacttttctcttagcagtgccgaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
953284 |
attaacttttctcttagcagtgccgaa |
953310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University