View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_41 (Length: 295)
Name: NF20803_low_41
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_41 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 295
Target Start/End: Original strand, 44780750 - 44781035
Alignment:
| Q |
15 |
ttcatatctacaagcataagatactataactaacggttcacttatannnnnnnatcttcatttaatgatttcatatctacaagcatgtttagcaagcacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44780750 |
ttcatatctacaagcataagatactataactagcggttcacttatatttttttatcttcatttaatgatttcatatctacaagcatgtttagcaagcacc |
44780849 |
T |
 |
| Q |
115 |
aaaatattttactttatttt-ttgtttaagcatgcttgggatgaatcaaagatggataaaatggagatacgagatcatgaagaaggtaaagataagtgaa |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44780850 |
aaaatattttactttatttttttgtttaagcatgcttgggatgaatcaaagatggataaaatggagatacgagatcatgaagaaggtaaagataagtgaa |
44780949 |
T |
 |
| Q |
214 |
ccactagttgtaacaaattattattattatt----tnnnnnnnnntgcagtaaaacactgatttagaaaggtaagaatcaagggtg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44780950 |
ccactagttgtaacaaattattattattatttttataaaaaaaaatgcagtaaaacactgatttagaaaggtaagaatcaagggtg |
44781035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 44780734 - 44780766
Alignment:
| Q |
68 |
atcttcatttaatgatttcatatctacaagcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44780734 |
atcttcatttaatgatttcatatctacaagcat |
44780766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University