View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_49 (Length: 266)
Name: NF20803_low_49
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_49 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 266
Target Start/End: Complemental strand, 13882910 - 13882657
Alignment:
| Q |
9 |
ataattctgtgagaattttttatgaaagtgagggtagtagtcctggtgttggtgcgggtgcctaccatagtgaaaccaaaaccatataaatacttctaca |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13882910 |
ataattctgtgagaatttta-atgaaagtgagggtagtagtcctggtgttggtgcgggtgcctaccatagtgaaaccaaaaccatataaatacttctaca |
13882812 |
T |
 |
| Q |
109 |
gatggtgatcaatgttacccatgacatcactcaatttctagagaagataaatgtcttgatttagaccgtactgtgcgtaaaaatgaaactccatggtaag |
208 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13882811 |
gatg---atcaatgtgacccatgacatcactcaatttctagagaagataaatgtcttgatttagaccgtactgtgcgtaaaaatgaaactctatggtaag |
13882715 |
T |
 |
| Q |
209 |
ctgttagtgaaagctaatgtcatttctttgttaattgtgtttatggtactaagtgatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13882714 |
ctgttagtgaaagctaatgtcatttctttgttaattgtgtttatggtactaagtgatc |
13882657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 69 - 108
Target Start/End: Complemental strand, 13884737 - 13884698
Alignment:
| Q |
69 |
cctaccatagtgaaaccaaaaccatataaatacttctaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13884737 |
cctaccatagtgaaaccaaaaccatataaatacttctaca |
13884698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University