View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_50 (Length: 263)
Name: NF20803_low_50
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_50 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 43 - 263
Target Start/End: Complemental strand, 44800970 - 44800750
Alignment:
| Q |
43 |
ttagatgagtgttggaaaattttgagcgttcaaatatcattattgtttactaaaccccatgcatagttgtatcacacttctcctttcaaattgtgacatt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| || |||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
44800970 |
ttagatgagtgttggaaaattttgagcgtccaaatatcattattgtttattaaaccccttgtatagctgtatcatacttctcctttcaaattgtaacatt |
44800871 |
T |
 |
| Q |
143 |
tcaattcagttttcaaattgtaacattgtcttatcaatttctaacattaattccatatgagctagtcacataaccctactttccttgtaacattaaattt |
242 |
Q |
| |
|
||| |||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44800870 |
tcagttcagttttcgaattgtaacaatgtcagatcaatttctaacattaattccatatgagctagtcacataaccctactttccttgtaacattaaattt |
44800771 |
T |
 |
| Q |
243 |
gaaacaatgtccatttaagtt |
263 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44800770 |
gaaacaatgtccatttaagtt |
44800750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University