View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_52 (Length: 260)
Name: NF20803_low_52
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 25 - 250
Target Start/End: Original strand, 33785407 - 33785633
Alignment:
| Q |
25 |
tatcaggttcaaacgcaagtgatcggtacgcagtgtgtgagtgttgtaaactctaggataccgagttcgattcttgataatnnnnnnnn--tgcataaag |
122 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33785407 |
tatcaggttcaaacgcaagtgatcg-tacgcagtgtgtgagtgttgtaaactctaggataccgagttcgattcttgataataaaaaaaaaatgcataaag |
33785505 |
T |
|
| Q |
123 |
aggaaacttacgatatgaagtcatgagcatttgcagacctagcagcctcaacaacttcattttcacttgcatcttgttttccaaacaaaatattgtcacg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33785506 |
aggaaacttacgatatgaagtcatgagcatttgcagacctagcagcctcaacaacttcattttcacttgcatcttgttttccaaacaaaatattgtcacg |
33785605 |
T |
|
| Q |
223 |
tatgctaccagaatatatcacaggttct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33785606 |
tatgctaccagaatatatcacaggttct |
33785633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University