View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_57 (Length: 250)
Name: NF20803_low_57
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 54 - 240
Target Start/End: Complemental strand, 29594096 - 29593910
Alignment:
| Q |
54 |
gaaaaacaatacattgaactaaatatgaatagtttatgttctgaaaatgaaatgcttgtcttttccatacccaaaatgcctgatcaaaccttgttcttga |
153 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29594096 |
gaaaaaaaaaacattgaactaaatatgaatagtttatgttctgaaaatgaaatgcttgtcttttctatacccaaaatgcttgatcaaaccttgttcttga |
29593997 |
T |
|
| Q |
154 |
gacaatactgtcatcattcaaatctgcagtttttgtattgttttttcgttctcttctagaactttctgttgccgacactatcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29593996 |
gacaatactgtcatcattcaaatctgcagtttttgtattgttttttcattctcttctagaactttctgttgccgacactatcctatg |
29593910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University