View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20803_low_69 (Length: 226)
Name: NF20803_low_69
Description: NF20803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20803_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 31877677 - 31877490
Alignment:
| Q |
17 |
atacgaaaaaccaaaagcaatatattgaatatttacatggattnnnnnnnnnnnnnnngacaaaacatcaagaacctctattttttgtctgcagtgcttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
31877677 |
atacgaaaaaccaaaagcaatatattgaatatttacatggattaaaaaaaatata---gacaaaacaccaagaacctctattttttatctgcagtacttt |
31877581 |
T |
 |
| Q |
117 |
agttacgacttccccaatattgctttcaatgtgatgtttaaattttttacttgtttttatcatcataagtatatgttagttattaattagttag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31877580 |
agttacgacttccccaatattgctttcaatgtgatgtttaaa---tttacttgtttttatcatcataagtatatgttagttgttaattagttag |
31877490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University