View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_high_19 (Length: 314)
Name: NF20804_high_19
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 87 - 299
Target Start/End: Complemental strand, 42117579 - 42117367
Alignment:
| Q |
87 |
tttgttttgttcatgttatgtaaaagaggcttatatagtgaagaagagacaaggtctaaagcattgaagactataattgatgtagaggagatcgacctaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117579 |
tttgttttgttcatgttatgtaaaagaggcttatatagtgaagaagagacaaggtctaaagcattgaagactataattgatgtagaggagatcgacctaa |
42117480 |
T |
 |
| Q |
187 |
tcatatatggcttggtttaaagagtttgcagctttgttggttcacctttgaagatgagaggttgagataaacaggatgaagggaagaagaataagtggat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117479 |
tcatatatggcttggtttaaagagtttgcagctttgttggttcacctttgaagatgagaggttgagataaacaggatgaagggaagaagaataagtggat |
42117380 |
T |
 |
| Q |
287 |
aaattgtgatagc |
299 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42117379 |
aaattgtgatagc |
42117367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University