View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_high_26 (Length: 269)
Name: NF20804_high_26
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 23 - 88
Target Start/End: Original strand, 43232345 - 43232410
Alignment:
| Q |
23 |
tttatttataagtttgtgttatgtttttatttctcctttttccttcttaaagctgcagtcttataa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43232345 |
tttatttataagtttgtgttatgtttttatttctcttttttccttcttaaagctgcagtcttataa |
43232410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 43233060 - 43233103
Alignment:
| Q |
110 |
agtttttcatattcttgagcttgaatctcattgttaaattactc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43233060 |
agtttttcatattcttgagcttgaatctcattgttaaattactc |
43233103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 253
Target Start/End: Original strand, 43233167 - 43233203
Alignment:
| Q |
217 |
tgttggagaaaacaatgattcaaatagagcaaagtat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43233167 |
tgttggagaaaacaatgattcaaatagagcaaagtat |
43233203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University