View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20804_high_31 (Length: 253)

Name: NF20804_high_31
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20804_high_31
NF20804_high_31
[»] chr3 (1 HSPs)
chr3 (1-236)||(52385690-52385925)


Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 52385925 - 52385690
Alignment:
1 tttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52385925 tttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctctg 52385826  T
101 ttgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccgtggctactttattagtaagatttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
52385825 ttgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccttggctactttattagtaagatttg 52385726  T
201 ttacatcatccttcatagtactattttgcatggtaa 236  Q
    ||||||||||||||||||||||||||||||||||||    
52385725 ttacatcatccttcatagtactattttgcatggtaa 52385690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University