View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_high_40 (Length: 240)
Name: NF20804_high_40
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 28321073 - 28321290
Alignment:
| Q |
1 |
tcggtggttagttaaaattgattgtaattagcatatgacactatataagtgcaacattactgttttactttnnnnnnnnn---gtgcaacattatgatac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
28321073 |
tcggtggttagttaaaattgattgtaattagcatatgacattgtatgagtgcaacattgctgttttacttttaaaaaaaaaaagtgcaacattatgatac |
28321172 |
T |
 |
| Q |
98 |
atttatcaaatttcacctttagttcgtttagaggaccaattcttgtctagtgaaccgtctttggcttttctctctggaactctttattttggctcggtct |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28321173 |
atttatcaaatttcac-tttagttcgtttagaggaccaattcttgtctagtgaaccgtctttggcttttctctctggaactctttattttggctcgttct |
28321271 |
T |
 |
| Q |
198 |
cacttcactcaatattgat |
216 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28321272 |
cacttcactcaatattgat |
28321290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University