View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_high_47 (Length: 205)
Name: NF20804_high_47
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_high_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 32739708 - 32739544
Alignment:
| Q |
18 |
gaatgtgcatttgtgttgcggacaagatgttcgtctaggcaaaactattgagttttatagacaagcttgtacttgtccaactaacttagtagctgaaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32739708 |
gaatgtgcatttgtgttgcggacaagatgttcgtctaggcaaaactattgagttttatagacaagcttgtacttgtccaactcacttagtagctgaaacc |
32739609 |
T |
 |
| Q |
118 |
atgtcgacgatgatggagtgtgtcaagctactttttctgttggccttgcttccctgatatacact |
182 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
32739608 |
atgtcgacaacgatggagtgtgtcaagctactttttctgttggcctcgcttccctggtatacact |
32739544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 66 - 163
Target Start/End: Original strand, 29133303 - 29133400
Alignment:
| Q |
66 |
tgagttttatagacaagcttgtacttgtccaactaacttagtagctgaaaccatgtcgacgatgatggagtgtgtcaagctactttttctgttggcct |
163 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29133303 |
tgagtttgatagacgagcttgttcttgtccaacttacttactagctgaaaccatgtcgacaacgatggagtgtgtcaagctactttttctgttggcct |
29133400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University