View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_low_17 (Length: 350)
Name: NF20804_low_17
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 331
Target Start/End: Original strand, 17594738 - 17595051
Alignment:
| Q |
18 |
agaaaaatcccaacacaatctttggatatatactacgtataaagggactccttagttttgagtctatagcacaattgggtatcatcttctatgtctttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594738 |
agaaaaatcccaacacaatctttggatatatactacgtataaagggactccttagttttgagtctatagcacaattgggtatcatcttctatgtctttgt |
17594837 |
T |
|
| Q |
118 |
cactggcttagagatgaacttagactcagtactaagagcaagaaaaaaggcatcaagcattgcaattgttggaacaattattccaatattatttggactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594838 |
cactggcttagagatgaacttagactcagtactaagagcaagaaaaaaggcatcaagcattgcaattgttggaacaattattccaatattatttggactt |
17594937 |
T |
|
| Q |
218 |
ggaacatattttttggttgggaaaaccaaaggatatgatgataattcatatatgaaccgtaatggttatttattatggtcattaattgttactatcacaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17594938 |
ggaacatattttttggttgggaaaaccaaaggatatgatgagaattcatatatgaaccgtaatgcttatttattatggtcattagttgttactatcacaa |
17595037 |
T |
|
| Q |
318 |
gttttccagtggtg |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17595038 |
gttttccagtggtg |
17595051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University