View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_low_32 (Length: 251)
Name: NF20804_low_32
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 32739444 - 32739209
Alignment:
| Q |
1 |
ccggcaattgctttgagcaagtactaatattgtaacatagacacatgataaaggttttggtcaaaataatgacttatatacattattttacatgtttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32739444 |
ccggcaattgctttgagcaagtactaatattgtaacacagacacatgataaaggttttggtcaaaataatgacttatatagattattttacatgtttgaa |
32739345 |
T |
|
| Q |
101 |
tattgtcaaaaaataaataaaatagattgatcaatttaattttaaacactagttggacaactaccctttcttgggtcacttatattagagtgtaagtgat |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32739344 |
tattgtcaaaaaataaataaaatggattgatcaatttaattttaaacactagttggacaactaccctttcttgggtcacttatattagagtgtaagtaat |
32739245 |
T |
|
| Q |
201 |
gtacatgcgaatttgtgtctttcgtcttcacttaat |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32739244 |
gtacatgcgaatttgtgtctttcctcttcacttaat |
32739209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 183
Target Start/End: Original strand, 7795024 - 7795056
Alignment:
| Q |
151 |
agttggacaactaccctttcttgggtcacttat |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
7795024 |
agttggacaacaaccctttcttgggtcacttat |
7795056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University