View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_low_36 (Length: 248)
Name: NF20804_low_36
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 120 - 239
Target Start/End: Complemental strand, 28320653 - 28320523
Alignment:
| Q |
120 |
gatgataccttttttgccaactggccatgatgggttcagctggactattcgacaaggtttgtcctc-----------atcattgtgcaagacatgcttgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
28320653 |
gatgataccttttttgccaactggccatgatgggttcagctggactattcgacaaggtttgtcctctacttggtttaatcattgtgtaagacatgcttgt |
28320554 |
T |
 |
| Q |
209 |
gttttgacatctttttctaggcatgttcctt |
239 |
Q |
| |
|
||| |||||||| |||||||||||||||||| |
|
|
| T |
28320553 |
gttgtgacatctgtttctaggcatgttcctt |
28320523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 28320771 - 28320708
Alignment:
| Q |
1 |
tcatctaaaaatacaagctgttgtgtgacaaatgtaggatctgatgctaccatgttcttttgcc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28320771 |
tcatctaaaaatacaagctgttgtgtgacaaatgtaggatctgattctaccatgttcttttgcc |
28320708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University